Analisis filogeni kerbau lokal (Bubalus bubalis) di Jawa Timur dan Yogyakarta berdasarkan sekuens DNA mitokondria gen cytochrome B / Dwi Sendi Priyono

Priyono, Dwi Sendi (2015) Analisis filogeni kerbau lokal (Bubalus bubalis) di Jawa Timur dan Yogyakarta berdasarkan sekuens DNA mitokondria gen cytochrome B / Dwi Sendi Priyono. Diploma thesis, Universitas Negeri Malang.

Full text not available from this repository.

Abstract

ABSTRAK Priyono, Dwi Sendi. 2015. Analisis Filogeni Kerbau Lokal (Bubalus bubalis) Di Jawa Timur dan Yogyakarta berdasarkan Sekuens DNA Mitokondria Gen Cytochrome b. Skripsi, Jurusan Biologi, Fakultas Matematika dan Ilmu Pengetahuan Alam, Universitas Negeri Malang. Pembimbing: (I) Prof. Dr.agr. Moh. Amin, S.Pd., M.Si (II) Sofia Ery Rahayu, S.P.d., M. Si. Kata Kunci : Filogeni, Bubalus bubalis, gen cytochrome b. haplotype network. Kerbau merupakan ternak yang potensial dalam penyediaan daging. Perkembangan populasi kerbau di Jawa Timur dan Yogyakarta pada tahun 2000 sampai tahun 2013 mengalami penurunan masing-masing sebesar 77,01% dan 85,37%. Apabila hal ini berlangsung terus menerus dikhawatirkan suatu saat akan mengalami kepunahan dan kita akan mengalami kerugian yang sangat besar karena kehilangan plasma nutfah, sehingga diperlukan suatu upaya konservasi Sebagai upaya konservasi plasma nuftah dapat memanfaatkan penanda molekuler gen cytochrome b DNA mitokondria. Penelitian ini bertujuan untuk: mengetahui hubungan kekerabatan (filogeni); menggambarkan haplotype network, dan mendeskripsikan variasi sekuens gen yang meliputi jarak genetik, similaritas, dan substitusi nukleotida, pada populasi kerbau lokal (Bubalus bubalis) di Jawa Timur dan Yogyakarta berdasarkan sekuens gen cytochrome b DNA mitokondria. Objek dalam penelitian ini adalah 6 sampel darah kerbau dikoleksi dari 4 kabupaten yaitu masing-masing Bangkalan (2 ekor), Lumajang (1 ekor), Madiun (1 ekor), dan Sleman (2 ekor). Isolasi DNA menggunakan buffer CTAB dan diamplifikasi dengan teknik Polymerase Chain Reaction (PCR) dengan primer forward AAAAAGCTTCCATCCAACATCTCAGCATGATGAAA (L14841), dan primer reverse AAACTGCAGCCCCTCAGAATGATATTTGTCCTCA (H1549). Produk PCR sepanjang ?? 380 base pair (bp) dan selanjutnya dilakukan sekuensing. Rekonstruksi pohon filogeni berdasarkan sekuen gen cytochrome b kerbau lokal (Bubalus bubalis) menggunakan metode Maximum Parsimony menunjukkan bahwa individu-individu kerbau mengelompok membentuk dua klaster pada pohon filogeni. Klaster I menunjukkan bahwa kerbau-kerbau dari Lumajang, Madiun, dan Yogyakarta mengelompok berdasarkan geografisnya didalam satu pulau yaitu Pulau Jawa. Sedangkan 2 sampel kerbau dari Bangkalan (A4 dan B1) mengelompok dalam satu klaster, yaitu klaster II Pulau Madura. Kerbau-kerbau di setiap klaster memiliki hubungan kekerabatan yang lebih dekat dengan didukung nilai similaritas yang tinggi dan jarak genetik yang rendah. Nilai jarak genetik Bubalus bubalis di wilayah Jawa Timur dan Yogyakarta berkisar antara 0,00-0,0088 dan untuk nilai variannya antara 0,00%-0,88%. Untuk similaritasnya berkisar antara 99,12% -100%. Analisis haplotype network mendukung hasil analisis menggunakan pohon filogeni dalam mempelajari variasi sekuen DNA pada level intraspesies. Hasil analisis median joining network kerbau dalam penelitian dengan spesies acuan, Bubalus bubalis arnee menunjukkan terbentuk?¼ 6 haplotype. Berdasarkan penggambaran haplotype network juga menunjukkan kerbau dari Madiun, Lumajang, Yogyakarta yang berada dalam satu daratan Pulau Jawa memiliki jaringan haplotype yang lebih dekat dan jarinngan haplotype yang lebih dekat ditunjukkan antar kerbau dari wilayah Bangkalan. Hasil ini juga mendukung pengelompokkan dua klaster pada pohon filogeni yang menunjukkan jaringan yang terbentuk lebih dekat antar haplotype di dalam setiap klasternya

Item Type: Thesis (Diploma)
Subjects: ?? ??
Divisions: Fakultas Matematika dan IPA (FMIPA) > Jurusan Biologi (BIO) > S1 Biologi
Depositing User: Users 2 not found.
Date Deposited: 10 Jul 2015 04:29
Last Modified: 09 Sep 2015 03:00
URI: http://repository.um.ac.id/id/eprint/26697

Actions (login required)

View Item View Item